View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_38 (Length: 324)
Name: NF0945_low_38
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 92 - 295
Target Start/End: Complemental strand, 40820269 - 40820066
Alignment:
| Q |
92 |
tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820269 |
tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc |
40820170 |
T |
|
| Q |
192 |
ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggatg |
291 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820169 |
ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatattcacatgttctttggata |
40820070 |
T |
|
| Q |
292 |
tgct |
295 |
Q |
| |
|
|||| |
|
|
| T |
40820069 |
tgct |
40820066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 40820350 - 40820312
Alignment:
| Q |
11 |
cataggtcattaactcgtttctatatcttaggagttagg |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40820350 |
cataggtcattaactcgtttctatctcttaggagttagg |
40820312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University