View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_40 (Length: 319)
Name: NF0945_low_40
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 30 - 311
Target Start/End: Complemental strand, 28156546 - 28156265
Alignment:
| Q |
30 |
tttaacacggtgaagaacggaaacagaaaccggaaactgaccggagaaatgattatcattaagatatagagatttgagattaacaagatttgagagatta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28156546 |
tttaacacggtgaagaacggaaacagaaaccggaaactgaccggagaaatcattatcattaagatatagagatttgagattaacaagatttgaaagatta |
28156447 |
T |
 |
| Q |
130 |
ggaatttgacccgaaagtgagtttcctttgaaactaagaactcgaagttgatccaaacggtttaaaatgtttgaatctaatttcccagttaagttgaaat |
229 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28156446 |
ggaatttgacccgaaagcgagtttcctttgaaactaagaactcgaagttgatccaaacggtttaaaatgtttgaatctaatttcccagttaagttgaaat |
28156347 |
T |
 |
| Q |
230 |
attcgagtactagctttctaactttgcctttgtaacaatctttaactcccacccaagtgcaaacatcattgttcttcttctc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28156346 |
attcgagtactagctttctaactttgcctttgtaacaatctttaactcccacccaagtgcaaacatcatcgttcttcttctc |
28156265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University