View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_42 (Length: 318)
Name: NF0945_low_42
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 103 - 236
Target Start/End: Original strand, 31099750 - 31099883
Alignment:
| Q |
103 |
caaacagatgacaacatttgtcacctacgaaagtttatttacggcctaaacccaacacaccacttgcctggttcaaaaccttgtgtaaatttctctatga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31099750 |
caaacagatgacaacatttgtcacctacgaaagtttatttacggcctaaacccaacacaccacttgcctggttcaaaaccttgtgtaaatttctctatga |
31099849 |
T |
 |
| Q |
203 |
ctatgggtttgtgaacttcaaatccgactcttct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31099850 |
ctatgggtttgtgaacttcaaatccgactcttct |
31099883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University