View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_56 (Length: 278)
Name: NF0945_low_56
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 151 - 246
Target Start/End: Original strand, 284257 - 284352
Alignment:
Q |
151 |
gccttagtctcaatcttaaacataaatatataatttttatattgtacctgagaagtgatccaacattagaaaaggatccaagttcttcatctcact |
246 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
284257 |
gccttagtctcaatctcaaacataaatatataatttttatattatacctgagaagtgatccaacattagaaaaggatccaagttcttcaactcact |
284352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University