View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_58 (Length: 271)
Name: NF0945_low_58
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 36 - 236
Target Start/End: Complemental strand, 43095665 - 43095465
Alignment:
| Q |
36 |
agggaatattaaaataaaaggtcttgctaacaagtatcataaagatacttgttaaagaaaccaaatatggtagctttctataatactttataaagacact |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
43095665 |
agggaatattaaaataaaaggtcttgctaacaagtatcataaagatacttgttaaagaaaccaaatatggtagctctttataatactttataaagacact |
43095566 |
T |
 |
| Q |
136 |
ctttagcattttcctaaaataaaatatcaaatttttggtactaccgattattatgagaacgtcctctcgaaagggactagtaagtgatacatgttgcaac |
235 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43095565 |
ctttaacatttccctaaaataaaatatcaaatgtttgttactaccaattattatgagaacgtcctctcgaaagggactagtaagtgatacatgttgcaac |
43095466 |
T |
 |
| Q |
236 |
a |
236 |
Q |
| |
|
| |
|
|
| T |
43095465 |
a |
43095465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University