View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_64 (Length: 256)
Name: NF0945_low_64
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 121 - 228
Target Start/End: Original strand, 6954293 - 6954400
Alignment:
| Q |
121 |
gttggattaatggacaggccaaattggaacgctttagttcataatatcaatccaaaagttcaaaccaatggactcgaatgctccaacacttataaacact |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6954293 |
gttggattaatggacaggccaaattggaacactttagttcataatatcaatccaaaagttcaaaccaatggactggaatgctccaacacttataaacact |
6954392 |
T |
 |
| Q |
221 |
ttagtttt |
228 |
Q |
| |
|
|||||||| |
|
|
| T |
6954393 |
ttagtttt |
6954400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 6954173 - 6954258
Alignment:
| Q |
1 |
ttttctttcttctttttgtggttttcattgtgaattattgatgctttgacttcaaatctgttactcattacaagcaatcacagttc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6954173 |
ttttctttcttctttttgtggttttcattgtgaattattgatgctttgacttcaaatctgttactcattacaagcaatcacagttc |
6954258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 228
Target Start/End: Complemental strand, 27837967 - 27837910
Alignment:
| Q |
171 |
tccaaaagttcaaaccaatggactcgaatgctccaacacttataaacactttagtttt |
228 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||| ||||||||||||| |||||||| |
|
|
| T |
27837967 |
tccaaaagttcaaatcaatggactcaaattctccaccacttataaacaccttagtttt |
27837910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University