View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_67 (Length: 252)
Name: NF0945_low_67
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_low_67 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 26510196 - 26510427
Alignment:
Q |
19 |
aaaacaacaaataagttaatagactagatatcaaatttagcaaaaagaaaatgtacgcatatttctcccctannnnnnnnnnccgacacatccatgcaat |
118 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
26510196 |
aaaacaacaaataagttaatagactaaatatcaaatttagcaaaaagaaaatgtacgcatatttctcccctattttttatttccgacacatccatgcaat |
26510295 |
T |
 |
Q |
119 |
cttcaacaagattattactaattgttgatctaaatttgtctgcgtgtggttataaaatttgttgtcttactcttacctggacaagatttaaagtcagtct |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
26510296 |
cttcaacaagattattactaattgttgatctaaatttgtctgcgtgtggttctaaaatttgttgtcttactcttacctggacaacatttaaagtcagtct |
26510395 |
T |
 |
Q |
219 |
tcactacacgcaagtaagcataaacgactgacac |
252 |
Q |
|
|
||||| |||||||||||||||||||||||||| |
|
|
T |
26510396 |
tcact--gcgcaagtaagcataaacgactgacac |
26510427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University