View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_68 (Length: 252)
Name: NF0945_low_68
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 42623346 - 42623569
Alignment:
| Q |
1 |
tcgtcaccgatttgaacgacggtgccatcgaatttcctcttcaacaacttgaagtgtccagaagaagccatgttaaccgttacacagatcaaaattaggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623346 |
tcgtcaccgatttgaacgacggtgccatcgagtttcctcttcaacaacttgaagtgtccagaagaagccatgttaaccgttacacagatcaaaattaggg |
42623445 |
T |
 |
| Q |
101 |
tttgtagagtgttgagttgtttgttgaaattgaatgaattatattatgaaagagaaacgaaaaaaggtgggaagaaataatattgaggaagcgggtatag |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623446 |
tttgtagagtgtcgagttgtttgttgaaattgaatgaattatattatgaaagagaaactaaaaaaggtgggaagaaataatattgaggaagcgggtatag |
42623545 |
T |
 |
| Q |
201 |
tgtctagatttctctcgaattctt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42623546 |
tgtctagatttctctcgaattctt |
42623569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University