View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_72 (Length: 251)
Name: NF0945_low_72
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_low_72 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 251
Target Start/End: Complemental strand, 5566602 - 5566359
Alignment:
| Q |
8 |
cgaagaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5566602 |
cgaacaatatcatcgcatcacttgtgtatgatagtacttctaatccagaggtaacctatccaacggatatcaaacgtcttgctcaactcgttatataaat |
5566503 |
T |
 |
| Q |
108 |
aagttcaagtcataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat |
207 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5566502 |
aagttcaagttataggcatgaccttaaataagctcaatttatttgcataatagaacgataagttcaacttattacgtgtaagcaataagcaatcataaat |
5566403 |
T |
 |
| Q |
208 |
tgagtagaataaattaggattgatgtgtcataatccgtaatatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5566402 |
tgagtagaataaattaggattgatgtgtcataatccgtaatatt |
5566359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University