View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0946_high_14 (Length: 250)
Name: NF0946_high_14
Description: NF0946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0946_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 35 - 240
Target Start/End: Original strand, 55117378 - 55117583
Alignment:
| Q |
35 |
ctacttatatacgaatatcacgatctttacttaatttgggtattcannnnnnnnnnnnnnnnnnaactggattggatatccgtggtgtgagactacaaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55117378 |
ctacttatatacgaatatcacgatctttacttaatttgggtattcattttttatgtttttttttaactggattggatatccgtggtgtgagactacaaag |
55117477 |
T |
 |
| Q |
135 |
agtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacataacgttgctgcattgtcgttttaaatgagatatg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
55117478 |
agtaatccttcaaaatatggtaggacaaattaacaatcaataacaaagttttctatcaaacaacttaacgttgctgcattgtcattttaaatgagatatg |
55117577 |
T |
 |
| Q |
235 |
cctttg |
240 |
Q |
| |
|
||||| |
|
|
| T |
55117578 |
tctttg |
55117583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University