View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0946_high_8 (Length: 286)
Name: NF0946_high_8
Description: NF0946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0946_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 48 - 221
Target Start/End: Complemental strand, 1494015 - 1493842
Alignment:
| Q |
48 |
aatattagccaaaagaagaatgatattctataaatatgcttatatatgggagcagccgcccaatcaaggttttaaccggttcaagaaggaaaactggacc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1494015 |
aatattagccaaaagaagaatgatattctataaatatgcttatatatgggagtagccgcccaatcaaggttttaaccggttcaagaaggaaaactggacc |
1493916 |
T |
|
| Q |
148 |
gaaccgttataataatttagtaaaattgaacagaattttttatggtttgtcgtgaatcaaaccaaactggtata |
221 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1493915 |
gaactgttataataatttagtaaaactgaacagaattttttatggtttgtcgtgaatcaaaccaaactggtata |
1493842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University