View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0946_low_12 (Length: 319)
Name: NF0946_low_12
Description: NF0946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0946_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 16549162 - 16548940
Alignment:
| Q |
1 |
cttatctcaaaactttataccctaggcacaagacaatgcaacttttgggctggcccaccatctaaggcttgtctgcttgtgacatggtagttgtcaacgc |
100 |
Q |
| |
|
|||||||||||||||||| ||| || |||||||||||||||||||||| || |||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
16549162 |
cttatctcaaaactttatccccgagacacaagacaatgcaacttttggtcttgcccaccatctaagtcttgtctccttgtgacatggtagttgtcaacgc |
16549063 |
T |
|
| Q |
101 |
aacctcaccctttattgcctctgcacacttttgttggatctagactacttgcatcttcgccttacatgacccaaaattgttgtttctagttaatttctcg |
200 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16549062 |
aacctcatcctttattgcctttgcacacttttgttggatctagactacttgcatcttcaccttccatgacccaaaattgttgtttctagttaatttctcg |
16548963 |
T |
|
| Q |
201 |
atattccacttggtagtgatgat |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
16548962 |
atattccacttgttagtgatgat |
16548940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 68 - 153
Target Start/End: Complemental strand, 31116329 - 31116244
Alignment:
| Q |
68 |
cttgtctgcttgtgacatggtagttgtcaacgcaacctcaccctttattgcctctgcacacttttgttggatctagactacttgca |
153 |
Q |
| |
|
|||||||| |||||||| ||||| | |||| ||| ||||||||| ||||||||| | ||||||||||||||| || ||||||||| |
|
|
| T |
31116329 |
cttgtctgattgtgacaatgtagtcgacaacacaagctcacccttcattgcctctacgcacttttgttggatcaagcctacttgca |
31116244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 88
Target Start/End: Complemental strand, 5898086 - 5898005
Alignment:
| Q |
7 |
tcaaaactttataccctaggcacaagacaatgcaacttttgggctggcccaccatctaaggcttgtctgcttgtgacatggt |
88 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| ||| ||| || | ||||||||| | ||| ||||||||||||||||| |
|
|
| T |
5898086 |
tcaaaactttatccccgaggcacaagacaatggcactcctggccttgtccaccatctcggtcttctctgcttgtgacatggt |
5898005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 11168784 - 11168747
Alignment:
| Q |
1 |
cttatctcaaaactttataccctaggcacaagacaatg |
38 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
11168784 |
cttatctcaaaactttatccccgaggcacaagacaatg |
11168747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 5192329 - 5192249
Alignment:
| Q |
5 |
tctcaaaactttataccctaggcacaagacaatgcaacttttgggctggcccaccatctaaggcttgtctgcttgtgacat |
85 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||| |||| || | ||||||||| | ||| || ||||||||||| |
|
|
| T |
5192329 |
tctcaaaactttatccccgaggcacaagacaatggcactcttggccttgtccaccatctcggtcttctccgcttgtgacat |
5192249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 63
Target Start/End: Complemental strand, 24749296 - 24749238
Alignment:
| Q |
5 |
tctcaaaactttataccctaggcacaagacaatgcaacttttgggctggcccaccatct |
63 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||||||| || | ||||||||| |
|
|
| T |
24749296 |
tctcaaaactttatccccgaggcacaagacaatggcacttttggccttgtccaccatct |
24749238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University