View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_high_38 (Length: 324)
Name: NF0947_high_38
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_high_38 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 30 - 324
Target Start/End: Complemental strand, 36453693 - 36453399
Alignment:
| Q |
30 |
ccaatttagttgttcccattcccaaataggttcaggttcatcgaccccattatttggtacatcattccaatttgtgccacttgaccctccaatattaaga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453693 |
ccaatttagttgttcccattcccaaataggttcaggttcatcaaccccattatttggtacatcattccaatttgtgccacttgaccctccaatattaaga |
36453594 |
T |
 |
| Q |
130 |
gaagcatcatggtctctctctatccctcgagaagttgcatacaaatttgatccattgagctctgccaccacttgttgagtacttgttgaagcagcatgtt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453593 |
gaagcatcatggtctctctctatccctcgagaagttgcatacgagtttgatccattgagctctgccaccacttgttgagtacttgttgaagcagcatgtt |
36453494 |
T |
 |
| Q |
230 |
gtaactccgtcgttggcctctctaatggtctacgatcaaacgaactaaagcttcctgatatcacataaacgcggcacaagctgaattcgcgtcgc |
324 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
36453493 |
gtaactccgtcattggcctctctaatggtcttcgatcaaacgaactaaagcttcccgatatcacataaacgcgacacaagctgaattcgtgtcgc |
36453399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University