View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_high_44 (Length: 297)
Name: NF0947_high_44
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_high_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 20 - 156
Target Start/End: Original strand, 33858611 - 33858747
Alignment:
| Q |
20 |
cttgctaaatttgcaatgccaacagtgttttatttcttctttgctttcgacttggctttaatatttaattttatgctaataagcattcatatgattgagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33858611 |
cttgctaaatttgcaatgccaacagtgttttatttcttctttgctttagacttggctttaatatttaattttatgctaataagcattcatatgattgagt |
33858710 |
T |
|
| Q |
120 |
attgcagcctagacttgtgtcaatttcgaacttcatc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33858711 |
attgcagcctagacttgtgtcaatttcgaacttcatc |
33858747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 86 - 156
Target Start/End: Original strand, 33868987 - 33869057
Alignment:
| Q |
86 |
aattttatgctaataagcattcatatgattgagtattgcagcctagacttgtgtcaatttcgaacttcatc |
156 |
Q |
| |
|
||||||||||||| ||| ||||| |||||||| ||||||||||| |||||| || |||||||||||||| |
|
|
| T |
33868987 |
aattttatgctaacaagtgttcatttgattgagcattgcagcctaagcttgtggcagtttcgaacttcatc |
33869057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University