View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_high_53 (Length: 273)
Name: NF0947_high_53
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0947_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 53 - 244
Target Start/End: Complemental strand, 9378908 - 9378699
Alignment:
Q |
53 |
tatgtttcttcttctcctgcttctgctgaataactactatattggctatattccatgttttctaattcaaacatcatgtgaaggagaggaatgttttttg |
152 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9378908 |
tatgtttcttcttctcctgcttctgctgaataactactatattggctatattccatgttttctaattcaaacatcatgtgaaggagaggaatgttttttg |
9378809 |
T |
 |
Q |
153 |
aggtagagagtgtgtttgtgttt------------------gtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttga |
234 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9378808 |
aggtagagagtgtgtttgtgtttgtgtttgtgtttgtgtttgtgtctttgccttgtgatgatatgcatgtatctatatatattggctttaagttatttga |
9378709 |
T |
 |
Q |
235 |
gttcatatca |
244 |
Q |
|
|
|||| ||||| |
|
|
T |
9378708 |
gttcttatca |
9378699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University