View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_14 (Length: 480)
Name: NF0947_low_14
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 232 - 470
Target Start/End: Original strand, 52876140 - 52876378
Alignment:
| Q |
232 |
catttcaaggggatgcataattgtatcgtaactctcactttaaggtataacatatgtcttatttcttctcataaaaagtaaaatatttgttcttttttca |
331 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876140 |
catttcaaggggatgcataattgtattgtaactctcactttaaggtataacatatgtcttatttcttctcataaaaagtaaaatatttgttcttttttca |
52876239 |
T |
 |
| Q |
332 |
tattgtgtgcttgttaacttttcatttgtttttcaaatttatgagcagcaaacgtcccaattttggtcagaagactgtgaatttacctatgtttggagag |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876240 |
tattgtgtgcttgttaacttttcatttgtttttcaaatttatgagcagcaaacgtcccaattttggtcagaagactgtgaatttacctatgtttggagag |
52876339 |
T |
 |
| Q |
432 |
atttctattttctcactggtggtgttgctattctctgtg |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876340 |
atttctattttctcactggtggtgttgctattctctgtg |
52876378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 107 - 163
Target Start/End: Original strand, 52876015 - 52876071
Alignment:
| Q |
107 |
gttggatagatttttctttactataaaaaatgtatcatatgaaactagtcaattcaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52876015 |
gttggatagatttttctttactataaaaaatgtatcatatgaaattagtcaattcaa |
52876071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 394 - 450
Target Start/End: Complemental strand, 256480 - 256424
Alignment:
| Q |
394 |
ttggtcagaagactgtgaatttacctatgtttggagagatttctattttctcactgg |
450 |
Q |
| |
|
||||||| ||||| |||||| ||||| | ||||| ||||||||||||||||| |||| |
|
|
| T |
256480 |
ttggtcaaaagaccgtgaatgtacctctatttggggagatttctattttctcgctgg |
256424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University