View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_16 (Length: 449)
Name: NF0947_low_16
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 146 - 437
Target Start/End: Complemental strand, 55572749 - 55572463
Alignment:
| Q |
146 |
gttttcacggttttttgtaataagatggatgagaaggattaggttgtttagcagcataaagatgaattgaaaggaaaaagtttcaggggtgactcgtgag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572749 |
gttttcacggttttttgtaataagatggatgagaaggattaggttgtttagcagcataaagatgaattgaaaggaaaaagtttcaggggtgactcgtgag |
55572650 |
T |
 |
| Q |
246 |
tgcttggttcaaaagtaaacttatcatattagccatagagagnnnnnnnggtgtttttggtgtatttaattgagctaccttccttgcttctgttctgttc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55572649 |
tgcttggttcaaaagtaaacttatcatattagccatagagagaaaaaaaggtgtttttggtgtatttaattgagctaccttccttgc-----ttctgttc |
55572555 |
T |
 |
| Q |
346 |
tgtttaggtttcttttcttgcatgcatcataatcaatcaatgttaagtagtggccacagtgcaaagctttgtagatttgagctttacattca |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55572554 |
tgtttaggtttcttttcttgcatgcatcataatcaatcaatgttaagtagtggccacagtgcaaagctttgtagatttgagctttgcattca |
55572463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 55572850 - 55572789
Alignment:
| Q |
36 |
tgaaatttcattgtataaagaaaatagaaacaaaatgaaggggagtttcatgaaaatatgtg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55572850 |
tgaaatttcattgtataaagaaaatagaaacaaaatgaaggggagtttcatgaaaatatgtg |
55572789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 7 - 40
Target Start/End: Complemental strand, 51805657 - 51805624
Alignment:
| Q |
7 |
aggtcaaattccaaaagaacttggattgttgaaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51805657 |
aggtcaaattccaaaagaacttggattgttgaaa |
51805624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University