View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_39 (Length: 356)
Name: NF0947_low_39
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 8e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 30 - 250
Target Start/End: Complemental strand, 35999259 - 35999037
Alignment:
| Q |
30 |
attattaatgtcacatagtatatcttagctattgtatttttattnnnnnnngttacatannnnnnnn--acaaataaatataattaatcctgaatcatat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
35999259 |
attattaatgtcacatagtatatcttagctattgtatatttattaaaaaaagttactttttttttttttacaaataaatataattaatcttgaatcatat |
35999160 |
T |
 |
| Q |
128 |
cttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaagacaagaagttatgccaaaacatttggtttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35999159 |
cttgggggttaagtgattagttaatagtgctgggtgggatgtcagagtatatgcatgcagtttatgtaagacaagaagttatgccaaaacatttggtttt |
35999060 |
T |
 |
| Q |
228 |
ggttattgttattaggtgttcat |
250 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35999059 |
ggttattgttattaggtgttcat |
35999037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University