View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_41 (Length: 350)
Name: NF0947_low_41
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 43602701 - 43603010
Alignment:
| Q |
30 |
atcagcagctacaagatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttg |
129 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602701 |
atcagcaactacaagatcaagtaaatttagatggaaaatgttgtggatgaagctcaagaaagagaagaagaagctacttgagtctacatcatcacctttg |
43602800 |
T |
 |
| Q |
130 |
cagcaggatccttatgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattacctgtctagatctttctctgttcggt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602801 |
cagcaggatccttatgatcctttcacttattctcagaattttgaacaagggacagtgtttgatgaaccagattacctgtctagatctttctctgttcggt |
43602900 |
T |
 |
| Q |
230 |
ttgccgatccttgtaaatttattaattatcaaaagaaatgagtagtttaaggcaaagctagggaaatttgagactttatgttagcaatgtttgcatctct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43602901 |
ttgccgatccttgtaaatttattaattatcaaaagaaatgagtagtttaaggcaaagctagggaaatttgagactttatgttagcaatgtttgcatctct |
43603000 |
T |
 |
| Q |
330 |
ttttcttcat |
339 |
Q |
| |
|
|||||||||| |
|
|
| T |
43603001 |
ttttcttcat |
43603010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University