View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_46 (Length: 337)
Name: NF0947_low_46
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 143 - 255
Target Start/End: Complemental strand, 26262804 - 26262692
Alignment:
| Q |
143 |
gaagaaatgtactattgttctccataatcgtcattttcttctttgcgttggtaaaatatgaaaatgaaatttgctagatcgttttaatgcttttattttt |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26262804 |
gaagaaatgtactattattctccataattgtcattttcttctttgcgttggtaaaatatgaaaatgaaatttgctagatcgttttaatgcttttattttt |
26262705 |
T |
|
| Q |
243 |
gtatattgttgga |
255 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
26262704 |
ttatatttttgga |
26262692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 116 - 155
Target Start/End: Complemental strand, 26262850 - 26262811
Alignment:
| Q |
116 |
ggttgcaacatattttatcaacgcaaagaagaaatgtact |
155 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26262850 |
ggttgcaacatattttaccaaggcaaagaagaaatgtact |
26262811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University