View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_52 (Length: 323)
Name: NF0947_low_52
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 29 - 154
Target Start/End: Original strand, 50117495 - 50117620
Alignment:
| Q |
29 |
attctcatggatacattgagttgatatatgaacattaagtggttttatgttacacctttctgtcttaaagtgcatttgccttgctatttaatgtttggtt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117495 |
attctcatggatacattgagttgatatatgaacattaagtggttttatgttacacctttctgtcttaaagtgcatttgccttgctatttaatgtttggtt |
50117594 |
T |
|
| Q |
129 |
gcagttttccaatgcaattaatgagt |
154 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
50117595 |
gcagttttcccatgcaattaatgagt |
50117620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 195 - 313
Target Start/End: Original strand, 50117630 - 50117748
Alignment:
| Q |
195 |
cagtcacatttaatgcttttggtcatcccctagatgagcagcacgtctgttgagtacattcctccctgacatcttttccgttctttaatttaatggaatc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117630 |
cagtcacatttaatgcttttggtcatcccctagatgagcagcacgtctgttgagtacattcctccctgacatcttttccgttctttaatttaatggaatc |
50117729 |
T |
|
| Q |
295 |
agtcatgcaaatctctgtg |
313 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50117730 |
agtcatgcaaatctctgtg |
50117748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University