View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_54 (Length: 315)
Name: NF0947_low_54
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 266
Target Start/End: Complemental strand, 18389577 - 18389341
Alignment:
| Q |
30 |
atcgggtctaagtggcggtcaaaaggcggggatagtaataggtacacttatggcagctgccatattaggtttcattggaatggtttactggaagcgccga |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18389577 |
atcgggtctaagtggcggtcaaaaggcggggatagtaataggtacacttctgggagctgccatattaggtttcattggaatggtttgctggaagcgccga |
18389478 |
T |
 |
| Q |
130 |
gttaacactagaagaaaccattatagtgatgctgccagaaacattgaactttgatcttacaaattaaggatttgttttgtcctgaaacattttaatttta |
229 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18389477 |
gttaacattagaagaaaccgttatagtgatgctgccagaaacattgaactttgatcttacaaattaaggatttgttttgtcctgaaacattttaatttta |
18389378 |
T |
 |
| Q |
230 |
ctttcaaaatgcaaggaaacttcggaaaatggtcggg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18389377 |
ctttcaaaatgcaaggaaacttcggaaaatggtcggg |
18389341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University