View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_62 (Length: 282)
Name: NF0947_low_62
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 6219245 - 6219039
Alignment:
| Q |
17 |
ccaacaatatttttccgatggttgatgttcataacagcgatgcaaaactcacattatatctaactatatgccaaaagggacattacgaagttctccgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6219245 |
ccaacaatatttttccgatggttgatgttcataacagcgatgcaaaactcacattatatctaactatatgccaaaagggacattactaagttctccgatt |
6219146 |
T |
|
| Q |
117 |
agttcttttaataattcattgttcttatgccaaacgggatatgaaagttgtaacaccctaaattttcaagaaaccctaggattgtgagctgaagtgtgat |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6219145 |
agttcttttaataattcattgttcatatgccaaaagggatatgaaagttgtaacaccctaaattttcaagaaaccctaggattgtgagctgacgtgtgat |
6219046 |
T |
|
| Q |
217 |
aagctta |
223 |
Q |
| |
|
||||||| |
|
|
| T |
6219045 |
aagctta |
6219039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University