View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_64 (Length: 281)
Name: NF0947_low_64
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 29 - 258
Target Start/End: Original strand, 30416184 - 30416401
Alignment:
| Q |
29 |
atgtaccttagcttttaagggattgatgattctgcaagatttttcccttgtgaatgagtctttgattttggattgggatgtcacagtttcgaacgacaag |
128 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30416184 |
atgtaccatagcttttatgggattgatgattctgcaagatttttcccttgtgaatgagtctttgattttggattgggatgtcacagtttccaacgacaag |
30416283 |
T |
 |
| Q |
129 |
ctctttgaaggattcaactgtggattcgagtgcagcttcaacacaaaactttgaaccattgaagaaacgaacattgatgtctacactttcagcaacgccc |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30416284 |
ctctttgaaggat------------tcgagtgcagcttcaacacaaaactttgaaccattgaagaaacgaacattgatgtctacactttcagcaacgccc |
30416371 |
T |
 |
| Q |
229 |
ttcaatttgcatgcaacaacttcttcatct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30416372 |
ttcaatttgcatgcaacaacttcttcatct |
30416401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 29 - 258
Target Start/End: Original strand, 31244585 - 31244814
Alignment:
| Q |
29 |
atgtaccttagcttttaagggattgatgattctgcaagatttttcccttgtgaatgagtctttgattttggattgggatgtcacagtttcgaacgacaag |
128 |
Q |
| |
|
||||||| ||||||| |||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| || || ||| |
|
|
| T |
31244585 |
atgtaccatagctttgcagggattgattattctgcaagatgtttcccttgtaaatgagtctttgattttggattgggatgtcacagtttccaatgataag |
31244684 |
T |
 |
| Q |
129 |
ctctttgaaggattcaactgtggattcgagtgcagcttcaacacaaaactttgaaccattgaagaaacgaacattgatgtctacactttcagcaacgccc |
228 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
31244685 |
ctgtttgaaggattcaactgtggattctagtgcagcttcaacacaaaactttgaaccattgaagtaacgaacattgatgtttacactttcagcgacgccc |
31244784 |
T |
 |
| Q |
229 |
ttcaatttgcatgcaacaacttcttcatct |
258 |
Q |
| |
|
||||||||||||||| ||||||||| |||| |
|
|
| T |
31244785 |
ttcaatttgcatgcagcaacttctttatct |
31244814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 109
Target Start/End: Original strand, 7206881 - 7206943
Alignment:
| Q |
45 |
aagggattgatgattctgcaagatttttcccttgtgaatgagtctttgattttggattgggatgt |
109 |
Q |
| |
|
||||||||||| ||||||||| ||||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
7206881 |
aagggattgattattctgcaa-atttttcg-ttgtaaatgagtctttgattttgtattgggatgt |
7206943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University