View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_71 (Length: 269)
Name: NF0947_low_71
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 42190688 - 42190580
Alignment:
| Q |
1 |
atgagtaccgatctcataatagttatgaaatgtattttaaatgacatgataattttcagggttgagaatgtnnnnnnntatgctaattgttggcggccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
42190688 |
atgagtaccgatctcataatagttatgaaatgtattttaaatgacatgataattttcagggttgagaatgtaaaaaaatatgctaattgttagcggccaa |
42190589 |
T |
|
| Q |
101 |
ctctcgggt |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
42190588 |
ctctcgggt |
42190580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 42209193 - 42209158
Alignment:
| Q |
11 |
atctcataatagttatgaaatgtattttaaatgaca |
46 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42209193 |
atctcataatagttatgaaatgtatttaaaatgaca |
42209158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University