View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_72 (Length: 269)
Name: NF0947_low_72
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 42190664 - 42190918
Alignment:
| Q |
1 |
taactattatgagatcggtactcatgtatatttttatttatttatatggaagcacatgagacttattagttattacaaacacgtatagattgcatcggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42190664 |
taactattatgagatcggtactcatgtatatttttatttatttatatggaagcacatgagacttattagttattacaaacacgtatagattgcatcggtt |
42190763 |
T |
 |
| Q |
101 |
agtacagacagattaaacatgtatagaaggaatgagaccaacatcacaagccaagatagatggattaattccatgcaattttgataaggcctctcacatg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42190764 |
agtacag----attaaacatgtatagaaggaatgagaccaacatcacaagccaagatagatggcttaattccatgcaattttgataaggcctctcacatg |
42190859 |
T |
 |
| Q |
201 |
acaaaccaactctcattacagcagttatggactcctcaactttatgcatcccatctgtg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42190860 |
acaaaccaactctcattacagcagttatggactcctcaactttatgcatcccatctgtg |
42190918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 200
Target Start/End: Original strand, 42209267 - 42209360
Alignment:
| Q |
108 |
acagattaaacatgtatagaaggaatgagaccaacatcacaagccaag-atagatggattaattccatgcaattttgataaggcctctcacatg |
200 |
Q |
| |
|
|||||||| ||| |||||| ||| || |||||||||||||||||| || ||||| | |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42209267 |
acagattatacaagtatagcaggcatcagaccaacatcacaagcctagtatagactgcttaattccatgcaattttgataaggcttctctcatg |
42209360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University