View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_80 (Length: 251)
Name: NF0947_low_80
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_80 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 14231307 - 14231487
Alignment:
| Q |
16 |
atagcaaaaacagaataataataaaaattgcttctactatgccaatgagtatgttcctgcaaattgcacatcaaagaatttgcaaagtacagtgatgcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14231307 |
atagcaaaaacagaataataataaaaattgcttctattatgccaatgagtatgttcttgcaaattgcacatcaaagaattttcaaagtacagtgatgcca |
14231406 |
T |
|
| Q |
116 |
cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccttcctcccaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14231407 |
cagttaatgtcataattcaaagttaaatatatcatcatctggatcaaattcatcttcgcaagtatcatccctcctcccaaa |
14231487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 247
Target Start/End: Original strand, 14231507 - 14231556
Alignment:
| Q |
198 |
ttcaaatcatcacgatcacattcatttctcctataactatgattcttatt |
247 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14231507 |
ttcaaatcatcatgatcacattcatttctcttataactatgattcttatt |
14231556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University