View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0947_low_84 (Length: 251)
Name: NF0947_low_84
Description: NF0947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0947_low_84 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 251
Target Start/End: Original strand, 48017286 - 48017531
Alignment:
| Q |
6 |
agtgagatgaaattataattgataacgaataaatcatacataccgacataggcaaagagaacacaatacacggctgctactattggcaatggtattgcag |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48017286 |
agtgatatgaaattataattgataacgaataaatcatacataccgacataggcaaagagaacacaatacacggctgctactattggcaatggtattgcag |
48017385 |
T |
 |
| Q |
106 |
caatcactgctccaaatttacctgatttataaacccggatacagtaagaaattaggcacacatgaaaagacaagctagtttaagttttaatcacttgaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48017386 |
caatcactgctccaaatttacctgatttataaacccggatacagtaagaaattaggcacacatgaaaagacaagctagtttaagttttaatcacttgaat |
48017485 |
T |
 |
| Q |
206 |
actctcattcactatatcataaatgtgagaacaatgttgtggtcat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48017486 |
actctcattcactatatcataaatgtgagaacaatgttgtggtcat |
48017531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University