View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_high_31 (Length: 212)
Name: NF0948_high_31
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0948_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 28 - 193
Target Start/End: Original strand, 9797987 - 9798152
Alignment:
Q |
28 |
gagatgaaccaatatggtcacttgcaccagaatccacaatccatgatccaatatttgagtgattcaaggaataagagaactttgttatacctgatgtaac |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9797987 |
gagatgaaccaatatggtcacttgcaccagaatccacaatccatgatccaatatttgagtgattcaaggaataagagaactttgttatacctgatgtaac |
9798086 |
T |
 |
Q |
128 |
atgtgaaactagattaaccttgctagaagatgctgattgattagctgcagatcatgaacactgaag |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9798087 |
atgtgaaactagattaaccttgctagaagatgctgattgattagctgcagatcatgaacactgaag |
9798152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University