View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_high_34 (Length: 204)
Name: NF0948_high_34
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0948_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 29007506 - 29007616
Alignment:
| Q |
1 |
gataaatttgattttgtgtccattctaaggtagttcatttgaagttagttaatcaatcgtgtaatacacgtgttttagtgtttctgtttacactttcaaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007506 |
gataaatttgattttatgtccattctgaggtagttcatttgaagttagttaatcaatcgtgtaatacacgtgttttagtgtttctgtttacactttcaaa |
29007605 |
T |
|
| Q |
101 |
tttggttgtat |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
29007606 |
tttggttgtat |
29007616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University