View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_high_36 (Length: 204)
Name: NF0948_high_36
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0948_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 29007506 - 29007622
Alignment:
Q |
1 |
gataaatttgattttgtgtccattctaaggtagttcatttgaagttagttaatcaatcgtgtaatacacgtgttttagtgtttctgtttacactttcaaa |
100 |
Q |
|
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29007506 |
gataaatttgattttatgtccattctgaggtagttcatttgaagttagttaatcaatcgtgtaatacacgtgttttagtgtttctgtttacactttcaaa |
29007605 |
T |
 |
Q |
101 |
tttggttgtatattctt |
117 |
Q |
|
|
||||||||||| ||||| |
|
|
T |
29007606 |
tttggttgtatgttctt |
29007622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University