View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_low_18 (Length: 403)
Name: NF0948_low_18
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0948_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 16 - 303
Target Start/End: Original strand, 51822333 - 51822620
Alignment:
| Q |
16 |
ctgaagaagaagaagtgcgtacatttttcctttgttgcacatgtttggtggaattgaacccgttaagaaattctccgaaacgtcgatgtattcaaattct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822333 |
ctgaagaagaagaagtgcgtacatttttcctttgttgcacatgtttggtggaattgaacccgttaagaaattctccgaaacgtcgatgtattcaaattct |
51822432 |
T |
 |
| Q |
116 |
gaccatgatccagtcttctgaggaattggacctgttaatctgtttctgtaaagagacagttcccggaggtttttaaactcacctatctccggtggaatct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822433 |
gaccatgatccagtcttctgaggaattggacctgttaatctgtttctgtaaagagacagttcccggaggtttttaaactcacctatctccggtggaatct |
51822532 |
T |
 |
| Q |
216 |
cgccggataatttgttttcgaagaaatgaagtgaaattagattacttaaaaaccttatctcagagagatttccttctaattgattcat |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822533 |
cgccggataatttgttttcgaagaattgaagtgaaattagattacttaaaaaccttatctcagagagatttccttctaattgattcat |
51822620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University