View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_low_23 (Length: 363)
Name: NF0948_low_23
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0948_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 13234208 - 13234559
Alignment:
Q |
1 |
tttttctatcaagactaatggtcctcaccttcatgggagttatgatggcaacaatgttccacaatccaaaaaataccttacaaggaatcacaaatcgtct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13234208 |
tttttctatcaagactaatggtcctcaccttcatgggagttatgatggcaacaatgttccacaatccaaaaaataccttacaaggaatcacaaatcgtct |
13234307 |
T |
 |
Q |
101 |
cagtttcttcattttcacagtgtgtctgtttttcttctcttcaaatgatgcggtccctgccttcatccaagagaggttcatcttcatccgcgaaacttct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13234308 |
cagtttcttcattttcacagtgtgtctgtttttcttctcttcaaatgatgccgtccctgccttcatccaagagaggttcatcttcatccgcgaaacttct |
13234407 |
T |
 |
Q |
201 |
cataatgcctatagagcttcttgttacaccatagctagcctaatcactcacatgccgtttcttgcgctccaagctttagcctatgctgccattgtttggt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13234408 |
cataatgcctatagagcttcttgttacaccatagctagcctaatcactcacatgccgtttcttgcgctccaagctttagcctatgctgccattgtttggt |
13234507 |
T |
 |
Q |
301 |
ttgctttagaacttagaggcccatttatatacttcttccttgttctcttcat |
352 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13234508 |
ttgctttagaacttagaggcccatttatatacttcttccttgttctcttcat |
13234559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University