View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_low_26 (Length: 329)
Name: NF0948_low_26
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0948_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 50 - 283
Target Start/End: Original strand, 32017077 - 32017310
Alignment:
| Q |
50 |
gagatgaatgttgatgagattgaaggttttgccttgcctattttactagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag |
149 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017077 |
gagatggatgttgatgagattgaaggttttgccttgcctattttacgagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag |
32017176 |
T |
 |
| Q |
150 |
ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggtgttttcccctatgcggctgttctgctatctgtagtagtgctgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017177 |
ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggttttttcccctatgcggctgttctgctatctgtagtagtgctgct |
32017276 |
T |
 |
| Q |
250 |
gtcttnnnnnnntgcggggagtgttgttttctgc |
283 |
Q |
| |
|
||||| ||||||||||||||||| |||| |
|
|
| T |
32017277 |
gtcttgggggggtgcggggagtgttgtttactgc |
32017310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University