View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0948_low_30 (Length: 311)

Name: NF0948_low_30
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0948_low_30
NF0948_low_30
[»] chr2 (2 HSPs)
chr2 (122-222)||(37061108-37061208)
chr2 (1-56)||(37060986-37061041)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 37061108 - 37061208
Alignment:
122 gataattcatatatctattcttctcaaagtttagaaaagatgtaatgtttcattctctttttgttatggaacattccttttgatgctatgaagatgcttt 221  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||    
37061108 gataactcatatatctattcttctcaaagtttagaaaagaggtaatgtttcgttctctttttgttatggaacattccttttgatgctacgaagatgcttt 37061207  T
222 a 222  Q
    |    
37061208 a 37061208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 37060986 - 37061041
Alignment:
1 cacacttgagagtagatagttgaatttaagtgtgagtaattttgtccacgttaact 56  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
37060986 cacacttgagagtagatagttgaatttaagtgtaagtaattttgtccacgttaact 37061041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University