View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_low_30 (Length: 311)
Name: NF0948_low_30
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0948_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 122 - 222
Target Start/End: Original strand, 37061108 - 37061208
Alignment:
| Q |
122 |
gataattcatatatctattcttctcaaagtttagaaaagatgtaatgtttcattctctttttgttatggaacattccttttgatgctatgaagatgcttt |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37061108 |
gataactcatatatctattcttctcaaagtttagaaaagaggtaatgtttcgttctctttttgttatggaacattccttttgatgctacgaagatgcttt |
37061207 |
T |
|
| Q |
222 |
a |
222 |
Q |
| |
|
| |
|
|
| T |
37061208 |
a |
37061208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 37060986 - 37061041
Alignment:
| Q |
1 |
cacacttgagagtagatagttgaatttaagtgtgagtaattttgtccacgttaact |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37060986 |
cacacttgagagtagatagttgaatttaagtgtaagtaattttgtccacgttaact |
37061041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University