View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0948_low_40 (Length: 214)
Name: NF0948_low_40
Description: NF0948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0948_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 190
Target Start/End: Complemental strand, 9798152 - 9797986
Alignment:
| Q |
24 |
cttcagtgttcatgatctgcagctaatcaatcagcatcttctagcaaggttaatctagtttcacatgttacatcaggtataacaaagttctcttattcct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9798152 |
cttcagtgttcatgatctgcagctaatcaatcagcatcttctagcaaggttaatctagtttcacatgttacatcaggtataacaaagttctcttattcct |
9798053 |
T |
 |
| Q |
124 |
tgaatcactcaaatattggatcatggattgtggattctggtgcaagtgaccatattggttcatctct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9798052 |
tgaatcactcaaatattggatcatggattgtggattctggtgcaagtgaccatattggttcatctct |
9797986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University