View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_14 (Length: 325)
Name: NF0949_low_14
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 82 - 231
Target Start/End: Original strand, 38701514 - 38701670
Alignment:
| Q |
82 |
gaaggggaaagttatcaacaaataaggtgaaattttaaaagagaatggaatcgtgggagaaataaaaagtatgagggaaatagagctaatgggttggatt |
181 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38701514 |
gaaggggaaagttatcaacaaatgaggtgaaattttaaaagagaatggaatcgtgggagagataaaaagtatgagggagatagagctaatgggttggatt |
38701613 |
T |
|
| Q |
182 |
tggt-------gaccatgataagtttagtcacttgatctaatctagtgatggaaaaa |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38701614 |
tggtgctgctagaccatgataagtttagtcacttgatctaatctagtgatggaaaaa |
38701670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University