View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_19 (Length: 302)
Name: NF0949_low_19
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 59 - 242
Target Start/End: Complemental strand, 35117034 - 35116851
Alignment:
| Q |
59 |
tgagatgaatgggaaccgttcgcccactaaggcaagcttaactccaatcaagtctccaaggagttcaatgagtccgcagagacgtcaaagtgtcggtcct |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35117034 |
tgagatgaatgggaaccgttctcccactaaggcaagcttaactccaatcaagtctccaaggagttcaatgagcccgcagagacgtcaaagtgtcggtcct |
35116935 |
T |
|
| Q |
159 |
aatttccaggatgatggggttgttgagccttcaatcgagcagctttatgaaaatgtgtgtgatatgcagagttcttctcagtcg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35116934 |
aatttccaggatgatggggttgttgagccttcaatcgagcagctttatgaaaatgtgtgtgatatgcagagttctgatcagtcg |
35116851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University