View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_2 (Length: 526)
Name: NF0949_low_2
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 145 - 427
Target Start/End: Complemental strand, 13269378 - 13269096
Alignment:
| Q |
145 |
gaagtggatcatcaccatccaccaaatcatagattttattgaacaaaataaaaaggagcaaaagtataattcaagaatcacacaaagtgtgctatccatc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13269378 |
gaagtggatcatcaccatccaccaaatcatagattttattgaacaaaataaaaaggagcaaaagtataattcaagaatcacacaaagtgtgctatccatc |
13269279 |
T |
 |
| Q |
245 |
tatctatctcatctctgagatggcaatggcaatggctcttcgtaggctttcttcttccatcaacaaatcttcacgtcctctcttcagtgcttcttctgtt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13269278 |
tatctatctcatctctgagatggcaatggcaatggctcttcgtaggctttcttcttccatcaacaaatcttcacgtcctctcttcagtgcttcttctgtt |
13269179 |
T |
 |
| Q |
345 |
tactacaaggtaagtagcttcttcacttttcatcactcttcttttcaatattcaatcaaattcatacgtacatgcgcgcgcgc |
427 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13269178 |
tactacaaggttagtagcttcttcacttttcatcactcttcttttcaatattcaatcaaattcatacgtacatgcgcgcgcgc |
13269096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 44
Target Start/End: Complemental strand, 13269515 - 13269481
Alignment:
| Q |
10 |
aataatataatgaacacatgtatacgacaatattg |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13269515 |
aataatataatgaacacatgtatacgacaatattg |
13269481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University