View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0949_low_20 (Length: 297)

Name: NF0949_low_20
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0949_low_20
NF0949_low_20
[»] chr3 (1 HSPs)
chr3 (13-269)||(48652850-48653105)


Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 269
Target Start/End: Original strand, 48652850 - 48653105
Alignment:
13 aatattagggtatccccgattctaatttttatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa 112  Q
    |||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48652850 aatattagggtatccc-gattctaattttcatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa 48652948  T
113 tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatcctttacgactcagatg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48652949 tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatcctttacgactcagatg 48653048  T
213 gtagctcaattggtatcggtctggcaaaaatatacatgaaaaacgaatgtgaatgct 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48653049 gtagctcaattggtatcggtctggcaaaaatatacatgaaaaacgaatgtgaatgct 48653105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University