View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_20 (Length: 297)
Name: NF0949_low_20
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 269
Target Start/End: Original strand, 48652850 - 48653105
Alignment:
| Q |
13 |
aatattagggtatccccgattctaatttttatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48652850 |
aatattagggtatccc-gattctaattttcatgtttactagtatttgctttttggatagactttatattgatttgtagagcgacttttacggtagagaaa |
48652948 |
T |
 |
| Q |
113 |
tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatcctttacgactcagatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48652949 |
tatcttatataatatatgtggaccagtttttgaattgattgatatagtttctcttaattagaagttcataatattattattatcctttacgactcagatg |
48653048 |
T |
 |
| Q |
213 |
gtagctcaattggtatcggtctggcaaaaatatacatgaaaaacgaatgtgaatgct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48653049 |
gtagctcaattggtatcggtctggcaaaaatatacatgaaaaacgaatgtgaatgct |
48653105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University