View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_23 (Length: 278)
Name: NF0949_low_23
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 45546524 - 45546703
Alignment:
| Q |
1 |
tggtccatgtgtcaatgtcactgcatccaaaatagattcaaataaagtagnnnnnnntgcttcaaacttaaaaactaccaagtatagtatatattaactc |
100 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546524 |
tggtccatgtgtcagtgtcacttcatccaaaatagattcaaataaagtagaaaaaaatgcttcaaacttaaaaactaccaagtatagtatatattaactc |
45546623 |
T |
 |
| Q |
101 |
ttgcttcaaacaaaatgatatgatacctggatatggttcaacgttaggtgagttttgttcatcgttctccccttccacat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45546624 |
ttgcttcaaacaaaatgatatgatacctggatatggttcaacgttaggtgagttttgttcatcgttctccccttccacat |
45546703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University