View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_24 (Length: 265)
Name: NF0949_low_24
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 152 - 234
Target Start/End: Complemental strand, 31912599 - 31912518
Alignment:
| Q |
152 |
tagttttttctcttcttcaaattggaattataatatttaacctttatcttaattcacttcactcgcaagcatgggtatgatga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912599 |
tagttttttctcttcttcaaattggaat-ataatatttaacctttatcttaattcacttcactcgcaagcatgggtatgatga |
31912518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 115
Target Start/End: Complemental strand, 31912643 - 31912597
Alignment:
| Q |
69 |
ctaatgattttgatttctgaaaagtagataagaattcaattatatag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912643 |
ctaatgattttgatttctgaaaagtagataagaattcaattatatag |
31912597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University