View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0949_low_24 (Length: 265)

Name: NF0949_low_24
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0949_low_24
NF0949_low_24
[»] chr7 (2 HSPs)
chr7 (152-234)||(31912518-31912599)
chr7 (69-115)||(31912597-31912643)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 152 - 234
Target Start/End: Complemental strand, 31912599 - 31912518
Alignment:
152 tagttttttctcttcttcaaattggaattataatatttaacctttatcttaattcacttcactcgcaagcatgggtatgatga 234  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31912599 tagttttttctcttcttcaaattggaat-ataatatttaacctttatcttaattcacttcactcgcaagcatgggtatgatga 31912518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 115
Target Start/End: Complemental strand, 31912643 - 31912597
Alignment:
69 ctaatgattttgatttctgaaaagtagataagaattcaattatatag 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
31912643 ctaatgattttgatttctgaaaagtagataagaattcaattatatag 31912597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University