View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_32 (Length: 240)
Name: NF0949_low_32
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 122 - 231
Target Start/End: Complemental strand, 27134296 - 27134187
Alignment:
| Q |
122 |
ggctttgtcttttatatccttaagcccaccgcaacatcctgcagggggagggtcatcaccgggtgttgtagcatacccagcacatggatataaagtatct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27134296 |
ggctttgtcttttatatccttaagcccaccgcaacatcctgcagggggagggtcatcgccgggtgttgtagcatacccagcacatggatataaagtatct |
27134197 |
T |
|
| Q |
222 |
gtcacttcat |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
27134196 |
gtcacttcat |
27134187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University