View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_33 (Length: 237)
Name: NF0949_low_33
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 105 - 216
Target Start/End: Original strand, 8630485 - 8630599
Alignment:
| Q |
105 |
gggggaaatactcagctagatccatatgattttaagattatggtgcttaacgtaatatatctctc---atatgcaaatatgacaggtaaaatggcatggt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8630485 |
gggggaaatactcagctagatccatatgattttaagattatggtgcttaacgtaatatatctctcagtatatgcaaatatgacaggtaaaatggcatggt |
8630584 |
T |
 |
| Q |
202 |
aaatttcacataaaa |
216 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8630585 |
aaatttcacataaaa |
8630599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University