View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0949_low_4 (Length: 430)
Name: NF0949_low_4
Description: NF0949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0949_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 7e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 273 - 399
Target Start/End: Original strand, 53604672 - 53604798
Alignment:
| Q |
273 |
tctaattatatggcaatttatatgattaatttttgtttgcagatggtatcttttgttcagagtatgatgcttagagtggttccttccattttgagttaga |
372 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53604672 |
tctaattatatggcaatttatattattactttttgtttgcagatggtatcttttgttcagagtatgatgcttagagtggttccttccattttgagttaga |
53604771 |
T |
 |
| Q |
373 |
tggacatagttgatcagaaatctaatt |
399 |
Q |
| |
|
||||||| |||||||||||| |||||| |
|
|
| T |
53604772 |
tggacatggttgatcagaaacctaatt |
53604798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 128 - 208
Target Start/End: Original strand, 53604514 - 53604603
Alignment:
| Q |
128 |
aggcacctttcaattttcctggcttcagtat---------tggaattgcttgtgtaagaacttactttaatcaaagttctccatgctctc |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53604514 |
aggcaccttttaattttcctggcttcagtataatgtgcattggaattgcttcggtaagaacttactttaatcaaagttctccatgctctc |
53604603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University