View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_high_11 (Length: 266)
Name: NF0950_high_11
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0950_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 8188046 - 8188294
Alignment:
Q |
1 |
ggaaattgttttagaagcggcaggtatgatatctcaattggagattgataaggagaagaagaatgacttgattagtggtactagtgatggttttaggata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8188046 |
ggaaattgttttagaagcggcaggtatgatatctcaattggagattgataaggagaagaagaatgacttgattagtggtactagtgatggttttaggata |
8188145 |
T |
 |
Q |
101 |
gaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagatactgaggatgctatttgtatgcgtactagagctcgttattcgcttgaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8188146 |
gaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagatactgaggatgctatttgtatgcgtactagagctcgttattcgcttgaag |
8188245 |
T |
 |
Q |
201 |
gtttcagtcttgatgagcttgagaccttccttcaagagaccgatgatga |
249 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
8188246 |
gtttcagtcttgatgagcttgagacctttcttcaagagactgatgatga |
8188294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University