View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0950_high_12 (Length: 265)

Name: NF0950_high_12
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0950_high_12
NF0950_high_12
[»] chr4 (1 HSPs)
chr4 (23-223)||(32214808-32215004)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 23 - 223
Target Start/End: Complemental strand, 32215004 - 32214808
Alignment:
23 cacagacatgtccatacagatttcccttgttatgcaattcatggtttggatcatgcaacatccgcacgcgcgaggcatgtgcactcgaggtgttttccct 122  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||    
32215004 cacacacatgtccatacagatttcccttgttatgcaattcatggtttgcatcatgcaacatccacacgcgcgaggcatgtgcactcgaggtgttttccct 32214905  T
123 tgatttctacactcttcatggnnnnnnnnnnnnnnnacctttgacatgtgaatggtacttgggacaaaatttctccaagttgtcttttgattggatcaat 222  Q
    ||||||||||||||||||| |               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32214904 tgatttctacactcttcattg----ggtttttttttacctttgacatgtgaatggtacttgggacaaaatttctccaagttgtcttttgattgggtcaat 32214809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University