View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_high_24 (Length: 203)
Name: NF0950_high_24
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_high_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 14513340 - 14513217
Alignment:
| Q |
1 |
ttatgccattaatccttctcaagaagtatttttaccgttgctaaataaattaaccactgcaaaagtggaattaagccctatttttgatgctatagatgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14513340 |
ttatgccattaatccttctcaagaagtatttttaccgttgctaaataaattaatcactgcaaaagtggaattaagccctatttttgatgctatagatgag |
14513241 |
T |
|
| Q |
101 |
tcttcttcaaaccaagtaactatc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14513240 |
tcttcttcaaaccaagtaactatc |
14513217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University