View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_high_7 (Length: 327)
Name: NF0950_high_7
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 277
Target Start/End: Original strand, 21376931 - 21377207
Alignment:
| Q |
2 |
caaaccaacaccttcactcttcgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376931 |
caaaccaacaccttcactctttgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac |
21377030 |
T |
 |
| Q |
102 |
ctcatctttgctaaaccacatgaatatagcgccttctgctannnnnnnagaacgagaccttctcgttgcagtcttcagaatgagacctttcttcattgtg |
201 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21377031 |
cttatctttgctaaaccacatgaatatagcgccttctgctatttttttagaacgagaccttctcgttgcagtcttcagaatgagacctttcttcattgtg |
21377130 |
T |
 |
| Q |
202 |
tttgagactgcaacttttcccttaggatatgacatcaatttggcttcactaattctgag-ttttctctccctatgat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
21377131 |
tttgagactgcaacttttcccttaggatatggcatcaatttggcttcactaattctgagtttttctctcccaatgat |
21377207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 161 - 276
Target Start/End: Complemental strand, 36186198 - 36186082
Alignment:
| Q |
161 |
ttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatgacatcaatttggcttcactaattctgag |
260 |
Q |
| |
|
|||||||||||||||||| || || | |||||||| ||| | ||||||||| ||||| |||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
36186198 |
ttctcgttgcagtcttcaaaacgaaatttttcttcactgtatccgagactgcagcttttgccttaggatatggcatcaattaggcttcactaattatgag |
36186099 |
T |
 |
| Q |
261 |
tt-ttctctccctatga |
276 |
Q |
| |
|
|| ||||||||| |||| |
|
|
| T |
36186098 |
ttcttctctcccaatga |
36186082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University