View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_16 (Length: 399)
Name: NF0950_low_16
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 84 - 303
Target Start/End: Complemental strand, 34078784 - 34078565
Alignment:
| Q |
84 |
aacaatattagtctcaaaaatcattcgagataggcatataggaaaatctccatctttgcataagaaaaataaccttcctcctggcccaccaaggtggcct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078784 |
aacaatattagtctcaaaaatcattcgagataggcatataggaaaatctccatctttggataagaaaaataaccttcctcctggcccaccaaggtggcct |
34078685 |
T |
 |
| Q |
184 |
attgttggtaaccttctccaattagggcaacttcctcatagagacttagcatcattatgtgataaatatggacccttagtttatttaaaattaggaaata |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078684 |
attgttggtaaccttctccaattagggcaacttcctcatagagacttagcatcattatgcgataaatatggacccttagtttatttaaaattaggaaata |
34078585 |
T |
 |
| Q |
284 |
ttgatgctattactactaat |
303 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34078584 |
ttgatgctattactactaat |
34078565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University